View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2768_high_16 (Length: 242)
Name: NF2768_high_16
Description: NF2768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2768_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 2926252 - 2926456
Alignment:
| Q |
13 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926252 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
2926351 |
T |
|
| Q |
113 |
tgttcccaacaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaacca |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926352 |
tgttcccagcaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaacca |
2926451 |
T |
|
| Q |
213 |
cacac |
217 |
Q |
| |
|
||||| |
|
|
| T |
2926452 |
cacac |
2926456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University