View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2768_low_21 (Length: 233)
Name: NF2768_low_21
Description: NF2768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2768_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 125 - 215
Target Start/End: Original strand, 44320514 - 44320604
Alignment:
| Q |
125 |
cccttcacattagcttctgcttgcatttcacatgtgagattgtttttgtcacactcggtattcaatcgagtatattcaagtatttgtttgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44320514 |
cccttcacattagcttctgcttgcatttcacatgtgagattgtttttgtcacactcggtattcaatcgagtatattcaagtatttgtttgt |
44320604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 44320359 - 44320409
Alignment:
| Q |
22 |
gtttggtggtgtgtgtaacttgttattaatttagtataatctataaccacc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44320359 |
gtttggtggtgtgtgtaacttgttattaatttagtataatctataaccacc |
44320409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 93 - 126
Target Start/End: Original strand, 44320431 - 44320464
Alignment:
| Q |
93 |
ttcctaagcaaaatatatagatcaagattaggcc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44320431 |
ttcctaagcaaaatatatagatcaagattaggcc |
44320464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University