View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2768_low_22 (Length: 226)
Name: NF2768_low_22
Description: NF2768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2768_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 2925842 - 2926058
Alignment:
| Q |
1 |
attttcatgtatgtctaaattcattgaaattttatgtacatattcattaacataatttagtgactggnnnnnnnnnnttactatatactatagcaatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2925842 |
attttcatgtatgtctaaattcattgaa-ttttatgtacatattcattaacataatttagtgactgggaaaaaaaaattactatatactatagcaatgta |
2925940 |
T |
 |
| Q |
101 |
atataaaatggagtagtttttattgtttatagaatttatttatacaccttgacc---nnnnnnnnnnnnngaatttatttatacactttacatgtaaaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
2925941 |
atataaaatggagtagtttttattgtttatagaatttatttatacaccttgaccaaaaaaaaaaaaaaaagaatttatttatacactgtacatgtaaaat |
2926040 |
T |
 |
| Q |
198 |
atttgtatacatgcatct |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2926041 |
atttgtatacatgcatct |
2926058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University