View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2770_low_5 (Length: 257)
Name: NF2770_low_5
Description: NF2770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2770_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 42257078 - 42256850
Alignment:
| Q |
19 |
gcaatatcgacactttagtttaacacgaacacgacattgacacatgattaaatttaattactttactcnnnnnnnnnnnnnnnatctatctatctgatgg |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
42257078 |
gcaatatcgacactttagtttgacacgaacacgacattgacacatgattaaattcaattactttactctttttaaaattatt-atctatctatctgatgg |
42256980 |
T |
 |
| Q |
119 |
tgtcatgtttgactgtcccgtgtctgtgtcagtgcttcaaag-acctaaccataattcataggcatcacagaatccttcaagtttaaggttgttcatcag |
217 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42256979 |
tggcatgtttgactgtcccgtgactgtgtcagtacttcaaaggacctaaccataattcataggcatcacagaatccttcaagtttaaggttgttcatcag |
42256880 |
T |
 |
| Q |
218 |
ccacaaattgctacttatcggattcctttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42256879 |
ccacaaattgctacttatcggattcctttg |
42256850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University