View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2771_high_11 (Length: 227)
Name: NF2771_high_11
Description: NF2771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2771_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 7615115 - 7614908
Alignment:
| Q |
1 |
aagactaaaaggagttggtcttatttagttatgtataatgctttagcatagatacaaaataacaataaaaagtagaataaatcattttattatttccttt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
7615115 |
aagactaaaaggagttagtcttatttagttatgtataattctttagcacagatacaaaacaacaataaaaagtagaatcaatccttttatcatttccttt |
7615016 |
T |
|
| Q |
101 |
gnnnnnnnnnctgctttta-------taggagaagtgtttattatatgtaaatgtatttaagtattatacatatggtattatgacaagactaattcaact |
193 |
Q |
| |
|
|| |||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
7615015 |
--aaaaaaaactccttttattattattaggagaagtgtttattatatgtaaatgtgtttaagtattatacatttggtattatgacaagactaatttgact |
7614918 |
T |
|
| Q |
194 |
aaaagttata |
203 |
Q |
| |
|
|||||||||| |
|
|
| T |
7614917 |
aaaagttata |
7614908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University