View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2771_high_14 (Length: 206)
Name: NF2771_high_14
Description: NF2771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2771_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 66 - 199
Target Start/End: Complemental strand, 33499722 - 33499587
Alignment:
| Q |
66 |
tgggaatcagataaatacaatgtgaaattagggtttggtaaaaatgagagtgcttggaataagttacaagattaagagaaag--cactacgcatgtaagc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33499722 |
tgggaatcagataaatacaatgtgaaattagggtttggtaaaaatgagagtgcttggaataagttacaagattaagagaaagcacactacgcatgtaagc |
33499623 |
T |
|
| Q |
164 |
aagtaagagaggaagtagatagcaaagggaaggaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499622 |
aagtaagagaggaagtagatagcaaagggaaggaca |
33499587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University