View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2771_high_8 (Length: 246)
Name: NF2771_high_8
Description: NF2771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2771_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 73 - 230
Target Start/End: Complemental strand, 7614520 - 7614363
Alignment:
| Q |
73 |
attcaaatctcaataagatagtttgttcaatagaatttcgaaacgtagcaagccaatatataaacaattaacgactatttcggacaaaagagaacaatga |
172 |
Q |
| |
|
||||| || ||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7614520 |
attcacatatcaatcacatagtttgttcaatagaatttcgaaacgtagcaagcccatatataaacaattaacgactatttcggacaaaagagaccaatga |
7614421 |
T |
 |
| Q |
173 |
aggacacatttttagaggtattcgnnnnnnntaatattgatctattgtcatttctctc |
230 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
7614420 |
aggacaaatttttagaggtattcgaaaaaaataatattgatatattgtcttttctctc |
7614363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University