View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2771_low_14 (Length: 216)
Name: NF2771_low_14
Description: NF2771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2771_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 25051461 - 25051660
Alignment:
| Q |
1 |
cgtttaataacagagttgactcgtattgccaaagtcaaacttaacttgcaatttttcaaataacttataactaaatttacaaaactatgaatgtgtagca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25051461 |
cgtttaattacagagttgactcgtattgccaaagtcaaacttaacttgcaatttttcaaataacttataactaaatttacaaaactatgaatgcgtagca |
25051560 |
T |
 |
| Q |
101 |
ggaacataatatgaatccatcacacattcatatttaagagacactaaagtctaaacacaaaataacaacgtaaaattggtcattgctttctataatctat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25051561 |
ggaacacaatatgaatccatcacacattcatatttaagagacactaaagtctaaacacaaaataacaacgtaaaattggtcattgctttctataatctat |
25051660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University