View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2772_high_6 (Length: 224)
Name: NF2772_high_6
Description: NF2772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2772_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 28186363 - 28186568
Alignment:
| Q |
1 |
agatgagtatcctcaaggcacttcagcgcagtgtgtgcaccgatgaagtgatagtaataataaaagtgctatttcaagttttcaacatcttgaataactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28186363 |
agatgagtatcctcaaggcacttcagcgcagtgtgtgcaccgatgaagtgatagtaataataaaagtgctatttcaagttttcaacatcttgaataactt |
28186462 |
T |
 |
| Q |
101 |
gattcactttaagaatgatatgcgagttgaaccaaaccaactatttaggttaggataaatatatgtttttccattacagatttgatcatcaactaaagtt |
200 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
28186463 |
gactcactttaagaatgatatacgagttgaaccaaaccaactatttaggttaggataaatatatgttttttcgttacagatttgatcatcaactaaagtt |
28186562 |
T |
 |
| Q |
201 |
aggatt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
28186563 |
aggatt |
28186568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University