View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2772_high_7 (Length: 213)
Name: NF2772_high_7
Description: NF2772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2772_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 2788969 - 2789152
Alignment:
| Q |
16 |
attttgtgggataagcagacttgattgtgaagatattatgctcactctcatnnnnnnnnc--tctaagatcgatacttaattgaaataaataaggccttc |
113 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2788969 |
attttgtgggataag---acttaattgtgaagatattatgctcactctcataaaaaaaacactctaagttcgatacttaattgaaataaataaggccttc |
2789065 |
T |
 |
| Q |
114 |
aatttgattacaaacactcaattatagtattatatgattgtcacttaca-nnnnnnnncacagttcatttttagaggtaatgatatt |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2789066 |
aatttgattacaaaaactcaattatagtattatatgattgtcacttacatttttttttcacagttcatttttagaggtaatgatatt |
2789152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University