View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2774_high_4 (Length: 272)
Name: NF2774_high_4
Description: NF2774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2774_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 55 - 259
Target Start/End: Original strand, 28025282 - 28025486
Alignment:
| Q |
55 |
aataacttaacaacaccaccatcaactctttttcttccttttctcccgttaacaatgtagcttatacaaaatttcctgttacgctcaaatttctcttatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28025282 |
aataacttaacaacaccaccatcaactttttttcttccttttctcctgttaacaatgtagcttatacaaaatttcctgttacgctcaaatttctcttatt |
28025381 |
T |
|
| Q |
155 |
ctttcttttttgggaaattttggaaaaaatannnnnnnnnataactagagtgaccctcttactcaaataacaaagtcgatattgctaggttggacacatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28025382 |
ctttcttttttgggaaattttggaaaaaatatttttttttataactagagtgaccctcttactcaaataacaaagtcgatattgctaggttggacacatt |
28025481 |
T |
|
| Q |
255 |
catct |
259 |
Q |
| |
|
||||| |
|
|
| T |
28025482 |
catct |
28025486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University