View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2774_high_6 (Length: 254)
Name: NF2774_high_6
Description: NF2774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2774_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 12187990 - 12187761
Alignment:
| Q |
8 |
tgagaagaacgatgatgacaagaattttaattaactttcggtgcacaagtgcttacatgaaactcagggcatgtaaatatcatgatgtacataagacttt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12187990 |
tgagaaggacgatgatgacaagaattttaattaactttcggtgcacaagtgcttacttgaaactcagggcatgtaaatatcatgatgtacataagtcttt |
12187891 |
T |
 |
| Q |
108 |
aattctaaaattatcatcggaaaggtgaaaggtatcagggtcgtttaagattagtttgatggaatga--gggtgtgtgtaac-ttttacagcatgaatct |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||| ||||| ||||| |
|
|
| T |
12187890 |
aattctaaaattatcatctgaaaggtgaaaggtatcagggtcgtttaagattagtttggtggaatgagggggtgtgtgtaactttttaaagcattaatct |
12187791 |
T |
 |
| Q |
205 |
aggtaaagaggaaagatgttgggttacaag |
234 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |
|
|
| T |
12187790 |
aggtaaagaagaaagatgttgggttccaag |
12187761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University