View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2774_low_12 (Length: 232)
Name: NF2774_low_12
Description: NF2774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2774_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 40395455 - 40395229
Alignment:
| Q |
7 |
gtatcttccatatagatcctttagacagtgaatatgagatnnnnnnncactgacagattgaaatgattcaaatgtcactacaccaaacaaatttccttaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40395455 |
gtatcttccatatagatcctttagacagtgaatatgagataaaaaaacactgacagattgaaatgattcaaatgtcactacaccaaacaaatttccttaa |
40395356 |
T |
 |
| Q |
107 |
ggctataagacacacctcatattgacatttgacaggtatctgttatggcttattataatagtaaaggaacctactttctgtttcattttgaa-nnnnnnn |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40395355 |
ggctataagacacacctcatattgacatttgacaggtatctgttatggcttattataatagtaaaggaacctactttctgtttcattttgaatttttttt |
40395256 |
T |
 |
| Q |
206 |
atggtttaatcaggtttatttctttat |
232 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40395255 |
atggtttaatcaggtttatttctttat |
40395229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University