View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2774_low_7 (Length: 264)
Name: NF2774_low_7
Description: NF2774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2774_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 22 - 256
Target Start/End: Original strand, 41916492 - 41916726
Alignment:
| Q |
22 |
tcttcaaccattgttcacatctttgtctttctcattcttctcttttatttttgtcaaaaactactatttcaaatggatcgtttttcttctactactatcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41916492 |
tcttcaaccattgttcacatctttgtctttctcattcttctcttttgtttttgtcaaaaactactatttcaaatggatcgtttttcttctactactatcc |
41916591 |
T |
 |
| Q |
122 |
cttttgcattacatggagcaaaagatgacctaaccatgcagatttctttgatttggagccaaatcaaagctccattaatcgttccattactaagaatatc |
221 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41916592 |
cttttgcattacaaggagcaaaagatgacctaaccatgcagatttctttgatttggagccaaatcaaagctccattaatcgttccattactaagaatatc |
41916691 |
T |
 |
| Q |
222 |
agtgtttttgtgtttgataatgtcggtgatgatgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41916692 |
agtgtttttgtgtttgataatgtcggtgatgatgt |
41916726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University