View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2775_high_6 (Length: 248)
Name: NF2775_high_6
Description: NF2775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2775_high_6 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 39 - 248
Target Start/End: Complemental strand, 53038055 - 53037854
Alignment:
| Q |
39 |
acattgctacatataattcaattaaattttatacttattttgtttaggttatttgtaaagtctagaattatccaacttaattatttttagtttctgcatg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
53038055 |
acattgctacatataattcaattaaattttatacttattttgtttaggttatttataaagtctagaattacccaactta----tttttagtttctgcatg |
53037960 |
T |
|
| Q |
139 |
tcaatacatccatgcatggatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaacgatc |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53037959 |
tcaatacatccatg----gatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaaagatc |
53037864 |
T |
|
| Q |
239 |
catcatcatc |
248 |
Q |
| |
|
|||||||||| |
|
|
| T |
53037863 |
catcatcatc |
53037854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 146 - 247
Target Start/End: Original strand, 39995636 - 39995737
Alignment:
| Q |
146 |
atccatgcatggatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaacgatccatcatc |
245 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| || |||||||||| | |||||| | ||||||| ||||||||| || |||||||| |
|
|
| T |
39995636 |
atccatccatggatcacacaatgtcttgataaaaatgcttcttaaagacatccatatggatctcttgtagacaaataataaccaacaaagaaccatcatc |
39995735 |
T |
|
| Q |
246 |
at |
247 |
Q |
| |
|
|| |
|
|
| T |
39995736 |
at |
39995737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University