View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2775_low_12 (Length: 225)

Name: NF2775_low_12
Description: NF2775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2775_low_12
NF2775_low_12
[»] chr3 (4 HSPs)
chr3 (16-209)||(2834679-2834872)
chr3 (122-167)||(2834621-2834666)
chr3 (165-208)||(2821490-2821533)
chr3 (119-164)||(2810124-2810169)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 2834679 - 2834872
Alignment:
16 tgaaatcaggcccggtgcaggcaaccagtttagatagtataagacnnnnnnnggcttcaaaacgatagtagcatcgatcttggttagcnnnnnnnncgat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||        ||||    
2834679 tgaaatcaggcccggtgcaggcaaccagtttagatagtataagactttttttggcttcaaaacgatagtagcatcgatcttggttagcaaaaaaaacgat 2834778  T
116 agtagagcgaagtgtctaactttgaatttttaaataaatagttggtgaggaaatgatggatggatgaaaccggttggctgagacgcatacatat 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2834779 agtagagcgaagtgtctaactttgaatttttaaataaatagttggtgaggaaatgatggatggatgaaaccggttggctgagacgcatacatat 2834872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 2834621 - 2834666
Alignment:
122 gcgaagtgtctaactttgaatttttaaataaatagttggtgaggaa 167  Q
    ||||||||||| ||||||||||||||||||||||||||| ||||||    
2834621 gcgaagtgtctgactttgaatttttaaataaatagttggcgaggaa 2834666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 2821533 - 2821490
Alignment:
165 gaaatgatggatggatgaaaccggttggctgagacgcatacata 208  Q
    |||||||||| |||||||||||||||||||||||| ||||||||    
2821533 gaaatgatgggtggatgaaaccggttggctgagacacatacata 2821490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 164
Target Start/End: Complemental strand, 2810169 - 2810124
Alignment:
119 agagcgaagtgtctaactttgaatttttaaataaatagttggtgag 164  Q
    |||||||||||| | ||||||||||| |||||||||||| ||||||    
2810169 agagcgaagtgtatgactttgaatttataaataaatagtcggtgag 2810124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University