View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2775_low_7 (Length: 320)
Name: NF2775_low_7
Description: NF2775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2775_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 10 - 303
Target Start/End: Original strand, 7750469 - 7750762
Alignment:
| Q |
10 |
ccaagaacgatggaattggtccactaagtctgtttgtgtccagcacaaggaggttaaggtttgtcagcttgctcaaggaatttggtattgtaccggtgag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7750469 |
ccaagaacgatggaattggtccactaagtctgtttgtgtcgagcacaaggaggttaaggtttgtcagcttgctcaaggaattcggtattgtaccggtgag |
7750568 |
T |
 |
| Q |
110 |
atggtttgcgcgaagattgagattattaagtctagacagttgaccaagagatgacggtatagagccagaaaatctgttggcgtaaagcatgagccctgtt |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750569 |
atggtttgcgcgaaggttgagattattaagtctagacagttgaccaagagatgatggtatagagccagaaaatctgttggcgtaaagcatgagccctgtt |
7750668 |
T |
 |
| Q |
210 |
agcctcttgagccggcccagggagggtgggattgggccggaaagtttgtttgctccaaaggtaatgctaatgaggttcgtcagttggctaagag |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7750669 |
agcctcttgagccggcccagggagggtgggattgggccggaaagtttgtttgctccaaagttaatgctaatgaggttcgtcagttggctaagag |
7750762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University