View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_high_13 (Length: 244)
Name: NF2776_high_13
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 226
Target Start/End: Original strand, 32984433 - 32984629
Alignment:
| Q |
30 |
actttatgcatgatgctatctaggttttcgtttttcacttgctttctgattaattcaaacttgaaaccctttgttttatttcttggtcttcatggtatat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32984433 |
actttatgcatgatgctatctaggttttcgtttttcacttgctttccgattaattcaaacttgaaaccctttgttttatttcttggtcttcatggtatat |
32984532 |
T |
|
| Q |
130 |
attatattactacttgatgatgattgatctatgatttgaagtgactatgtgctaatgtttgctatttcgtagttttatctatgtggttcaataatgg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32984533 |
attatattactacttgatgatgattgatctatgatttgaagtgactatgtgctaatgtttgctatttcgtagttttatctatgtagttcaataatgg |
32984629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 82 - 196
Target Start/End: Original strand, 39112980 - 39113102
Alignment:
| Q |
82 |
attcaaactt-gaaaccctttgttttatttcttggtcttcatgg-----tatatat-tat-attactacttgatgatgattgatctatgatttgaagtga |
173 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||| | ||||||| ||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39112980 |
attcaaactttgaaaccctttattttatttcttggtcttcaagtatagttatatatgtattattactacttgatcatgattgatctatgatttgaagtga |
39113079 |
T |
|
| Q |
174 |
ctatg-tgctaatgtttgctattt |
196 |
Q |
| |
|
|||| |||| ||||||||||||| |
|
|
| T |
39113080 |
-tatgctgctcatgtttgctattt |
39113102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 129 - 163
Target Start/End: Original strand, 39103765 - 39103799
Alignment:
| Q |
129 |
tattatattactacttgatgatgattgatctatga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39103765 |
tattatattactacttgatgatgattgatctatga |
39103799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University