View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2776_high_14 (Length: 243)

Name: NF2776_high_14
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2776_high_14
NF2776_high_14
[»] chr1 (2 HSPs)
chr1 (19-128)||(46708215-46708324)
chr1 (188-243)||(46708099-46708154)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 46708324 - 46708215
Alignment:
19 ctcttctgtgctatacttgggaatgcttgcgcttttgtacatcaatggagccttttataactgttctttagggattttgctttactttagaaaataaaat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46708324 ctcttctgtgctatacttgggaatgcttgcgcttttgtacatcaatggagccttttataactgttctttagggattttgctttactttagaaaataaaat 46708225  T
119 cttggtaatg 128  Q
    ||||||||||    
46708224 cttggtaatg 46708215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 188 - 243
Target Start/End: Complemental strand, 46708154 - 46708099
Alignment:
188 gagttggattttgtatctaattatgaactgggattcaaattttggttattgttgtt 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46708154 gagttggattttgtatctaattatgaactgggattcaaattttggttattgttgtt 46708099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University