View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_high_14 (Length: 243)
Name: NF2776_high_14
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 46708324 - 46708215
Alignment:
| Q |
19 |
ctcttctgtgctatacttgggaatgcttgcgcttttgtacatcaatggagccttttataactgttctttagggattttgctttactttagaaaataaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708324 |
ctcttctgtgctatacttgggaatgcttgcgcttttgtacatcaatggagccttttataactgttctttagggattttgctttactttagaaaataaaat |
46708225 |
T |
 |
| Q |
119 |
cttggtaatg |
128 |
Q |
| |
|
|||||||||| |
|
|
| T |
46708224 |
cttggtaatg |
46708215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 188 - 243
Target Start/End: Complemental strand, 46708154 - 46708099
Alignment:
| Q |
188 |
gagttggattttgtatctaattatgaactgggattcaaattttggttattgttgtt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708154 |
gagttggattttgtatctaattatgaactgggattcaaattttggttattgttgtt |
46708099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University