View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_high_15 (Length: 240)
Name: NF2776_high_15
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_high_15 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 128 - 240
Target Start/End: Original strand, 30078857 - 30078969
Alignment:
| Q |
128 |
ttatttgaattatattaaccatcaattttattgtcaaaataatagaaatggtgtcacaagagagtagaaacaaaaacaagtagaccacatgacaaataag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30078857 |
ttatttgaattatattaaccatcaattttattgtcaaaataacagaaatggtgtcacaagagagtagaaacaaaaacgagtagaccacatgacaaataag |
30078956 |
T |
 |
| Q |
228 |
tttcacaaaactc |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30078957 |
tttcacaaaactc |
30078969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 30078700 - 30078755
Alignment:
| Q |
20 |
gtacggtttaaattcttgtcacagagtctaacaattttgatctttttataagttcaac |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30078700 |
gtacggtttaaattcttgtcacag--tctaacaattttgatctttttataagttcaac |
30078755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University