View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_high_18 (Length: 223)
Name: NF2776_high_18
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_high_18 |
 |  |
|
| [»] scaffold0351 (1 HSPs) |
 |  |  |
|
| [»] scaffold1325 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 91 - 174
Target Start/End: Original strand, 11571006 - 11571087
Alignment:
| Q |
91 |
atgccactgtgtgtggtttgttttatacggtcccattgcacaaaatatatgtttatatatagtcatgccacattgtgttttata |
174 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11571006 |
atgccactgtgtgtggtttgttttatagggtcccattgcacaaaatatatgtt--aatatagtcatgccacattgtgttttata |
11571087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0351 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: scaffold0351
Description:
Target: scaffold0351; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 131 - 207
Target Start/End: Complemental strand, 3639 - 3565
Alignment:
| Q |
131 |
caaaatatatgtttatatatagtcatgccacattgtgttttataatgtgttttcactttaattatgctccaatttca |
207 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3639 |
caaaatatatgtttttata--gtcatgccacattgtgttttataatgtgttctcactttaattatgctccaatttca |
3565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1325 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1325
Description:
Target: scaffold1325; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 1987 - 2040
Alignment:
| Q |
22 |
gagtaggaaaggctgtagctgttgttttaccatctatcttgttgtattatgcag |
75 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||||| || ||||||| ||||| |
|
|
| T |
1987 |
gagtaggaaaggctgtagctattgattaaccatctatgttattgtattctgcag |
2040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University