View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_high_3 (Length: 399)
Name: NF2776_high_3
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Original strand, 53618276 - 53618670
Alignment:
| Q |
1 |
ttactgtgaatggatgttatacattcaagttacttgaacaggttgactgggttttccgtttgggcatatttactctgtttggcttgctgccaagtttcat |
100 |
Q |
| |
|
||||||| |||||| |||||||| |||||||||||||||| | ||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53618276 |
ttactgttgatggattttatacatacaagttacttgaacagagttactggtttgtccgtttgggcatatttactctgtttggcttgctgccaagtttcat |
53618375 |
T |
|
| Q |
101 |
ttggtggttgttgagccttttccgaaccttactagttaataattttgttgcagaatggaataatgcaaactcacgatgaagaaactcgaaagtttttcaa |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53618376 |
ttggtgtttgttgagccttttccgaaccttactagttaataattttgttgcagaatggaataatgcaaactcatgatgaagaaactcgaaagtttttcaa |
53618475 |
T |
|
| Q |
201 |
gcattcttcagtttcatgtgtgttgtcacctcgatatgccagcagtaagcttagcattttcaagcagcaggcatgctttatgctatggtttagtagcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53618476 |
gcattcttcagtttcatgtgtgttgtcacctcgatatgccagcagtaagcttagcattttcaagcagcaggcatgctttatgctatggtttagtagcttt |
53618575 |
T |
|
| Q |
301 |
cctagactgttttatgtttcttttaagaagttatgcatactatttcattatttccattctttcattacatcactctagttttaatatattcttgg |
395 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53618576 |
cctagacttttttatgtttcttttaagaagttatgcatactatttcattatttccattctttcattacatcactctagttttaatatattattgg |
53618670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University