View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2776_high_7 (Length: 268)

Name: NF2776_high_7
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2776_high_7
NF2776_high_7
[»] chr4 (4 HSPs)
chr4 (5-257)||(7890862-7891114)
chr4 (40-204)||(7876143-7876307)
chr4 (126-189)||(6792114-6792177)
chr4 (128-189)||(6748600-6748661)
[»] scaffold0729 (1 HSPs)
scaffold0729 (126-189)||(6452-6515)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 257
Target Start/End: Complemental strand, 7891114 - 7890862
Alignment:
5 tgtcatgtgataggagatgaacaattgttatacaatgctaaacatccggtgggagtagaagctcgggtgaaagatgtgattcaactattaaacagcgaac 104  Q
    |||||| |||||| |||  || ||| ||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
7891114 tgtcatttgatagaagaccaaaaatcgttattcattgctgaacatccggtgggagtagaagctcgggtgaaagatgtgattcaactattgaacagcgaac 7891015  T
105 aagcagaaaataccatgattgtagggatatgggggatgactggggttggtaaaacaataattgctaaagccacttataatcaaatgagtttcacttttga 204  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7891014 aagcagaaaataccatgattgtagggatatgggggatggctggggttggtaaaacaataattgctaaagccacttataatcaaatgagtttcacttttga 7890915  T
205 ttgcaagagctttctctataatgtcaatgaaacttgcaaatcgggtgatgatg 257  Q
    |||||||||| ||||| | ||||||||||||||||||||||||||||||||||    
7890914 ttgcaagagcattctcaagaatgtcaatgaaacttgcaaatcgggtgatgatg 7890862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 40 - 204
Target Start/End: Complemental strand, 7876307 - 7876143
Alignment:
40 tgctaaacatccggtgggagtagaagctcgggtgaaagatgtgattcaactattaaacagcgaacaagcagaaaataccatgattgtagggatatggggg 139  Q
    ||||||||| || |||||||||||||||||| || ||||||| ||||||||||| |||   |||||| ||||||||||||| ||  ||||| ||||||||    
7876307 tgctaaacacccagtgggagtagaagctcggatgcaagatgttattcaactattgaacgcggaacaaccagaaaataccataatcataggggtatggggg 7876208  T
140 atgactggggttggtaaaacaataattgctaaagccacttataatcaaatgagtttcacttttga 204  Q
    |  | ||||||||||||||||| ||| || ||||||||||  ||||||||||||| || ||||||    
7876207 acaaatggggttggtaaaacaacaatcgccaaagccacttgaaatcaaatgagttacaattttga 7876143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 189
Target Start/End: Original strand, 6792114 - 6792177
Alignment:
126 tagggatatgggggatgactggggttggtaaaacaataattgctaaagccacttataatcaaat 189  Q
    ||||||||||||||||||| ||| |||||||| |||  ||||| ||||||| |||| |||||||    
6792114 tagggatatgggggatgacagggattggtaaatcaaccattgccaaagccatttatgatcaaat 6792177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 128 - 189
Target Start/End: Original strand, 6748600 - 6748661
Alignment:
128 gggatatgggggatgactggggttggtaaaacaataattgctaaagccacttataatcaaat 189  Q
    ||||||||||||||| | |||||||||||| ||   ||||||||||||| |||| |||||||    
6748600 gggatatgggggatggcaggggttggtaaatcagctattgctaaagccatttatgatcaaat 6748661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0729
Description:

Target: scaffold0729; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 189
Target Start/End: Complemental strand, 6515 - 6452
Alignment:
126 tagggatatgggggatgactggggttggtaaaacaataattgctaaagccacttataatcaaat 189  Q
    ||||||||||||||||||| ||| |||||||| |||  ||||| ||||||| |||| |||||||    
6515 tagggatatgggggatgacagggattggtaaatcaaccattgccaaagccatttatgatcaaat 6452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University