View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_low_11 (Length: 268)
Name: NF2776_low_11
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 54631157 - 54631400
Alignment:
| Q |
18 |
acagcgttcccttcgtcggagacactctcacttcaccctgcaactgcaacaacaacaaccaccaccacgatgccaccgccgctgagatcatccctcccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54631157 |
acagcgttcccttcgtcggagacactctcacttcaccctgcaactgcaacaacaacaaccaccaccacgatgccaccgccgccgagatcatccctcccat |
54631256 |
T |
|
| Q |
118 |
catcccattgtccgctccagacacccatcacctcgataaccaagacgtttttcacactccgcgggaggacccaccgctttcatcttccgtcattgatgtt |
217 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| || |
|
|
| T |
54631257 |
catcccattgtacgctccagacacccagcacgtcgataaccaagacgtttttcacactccgccggaggacccaccgcttccatcttccgtcattgatctt |
54631356 |
T |
|
| Q |
218 |
tctcaatgtgagtttaatcaagctgttattgatgttgatgatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54631357 |
tctcaatgtgagtttaatcaagctgttattgatgttgatgatgt |
54631400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 44 - 217
Target Start/End: Complemental strand, 45314105 - 45313941
Alignment:
| Q |
44 |
ctcacttcaccctgcaactgcaacaacaacaaccaccaccacgatgccaccgccgctgagatcatccctcccatcatcccattgtccgctccagacaccc |
143 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||| || |||| || ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
45314105 |
ctcacttcaccgtgcaactgcaacaacaacaacctccaccaccat--cacc-------agttcatccctcccgtcatcctcttgtccgctccagacaccc |
45314015 |
T |
|
| Q |
144 |
atcacctcgataaccaagacgtttttcacactccgcgggaggacccaccgctttcatcttccgtcattgatgtt |
217 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
45314014 |
agcacgtcgataaccaagacgtttttcacactccgccggatgacccaccgcttccatcttccgtcattgatgtt |
45313941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University