View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2776_low_12 (Length: 256)
Name: NF2776_low_12
Description: NF2776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2776_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 7891109 - 7891351
Alignment:
| Q |
1 |
atgacacaaaccttgcactaggtcattgaattctttactttggctcctataaaatatgaggtaaagataagcagaaatgtaaatttagtagtattactat |
100 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7891109 |
atgacagaaaccttgcactatgtcattgatttcattatattggctcctataaaatatgaggtaaagataagcagaaatgtaaatttagtagtattactat |
7891208 |
T |
|
| Q |
101 |
tacatctcttat-----atcccttaaatagagaataaaagagcaattaactagtaatttcaaaatgcaaattgaaaaaagcttcaaagtttctctagtta |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7891209 |
tacatctcttatattatatcccttaaatagagaataaaagagcaattaactagtaatttcaaaatgcaaattgaaaaaagcttcaaagtttctctagtta |
7891308 |
T |
|
| Q |
196 |
cctggtgtccatcacccaaaatcctgaaatattggcagcttca |
238 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
7891309 |
cctggtgtccatcatccgaaatcctgaaatattggcagcttca |
7891351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University