View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2777_high_8 (Length: 284)

Name: NF2777_high_8
Description: NF2777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2777_high_8
NF2777_high_8
[»] chr2 (2 HSPs)
chr2 (65-269)||(44704378-44704578)
chr2 (9-52)||(44704307-44704350)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 65 - 269
Target Start/End: Original strand, 44704378 - 44704578
Alignment:
65 aaatgagtattgtgagatttattaattaattcaatcgtagaaaaaattgtgccctatagaattcagaatagaacaaatccccttctccaaaatctccagt 164  Q
    ||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44704378 aaatgagtattgtgagatttatta----attcaatcgtagaaaaaattgtgccctatagaattcagaatagaacaaatccccttctccaaaatctccagt 44704473  T
165 aacgaaaaataaactatgattttagcttcaataatatatgattaccgttgtgttgtagtaggctagtagcatagcaccggtaatagttgacttatgaaca 264  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44704474 aacgaaaaataaactatgattttagcttgaataatatatgattaccgttgtgttgtagtaggctagtagcatagcaccggtaatagttgacttatgaaca 44704573  T
265 gttat 269  Q
    |||||    
44704574 gttat 44704578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 44704307 - 44704350
Alignment:
9 gcaattcaatggtgtacatataagacaaatgctgtatgatgtat 52  Q
    |||||||||||||| |||||||||||||||||||||||||||||    
44704307 gcaattcaatggtgcacatataagacaaatgctgtatgatgtat 44704350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University