View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2777_low_12 (Length: 284)
Name: NF2777_low_12
Description: NF2777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2777_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 65 - 269
Target Start/End: Original strand, 44704378 - 44704578
Alignment:
| Q |
65 |
aaatgagtattgtgagatttattaattaattcaatcgtagaaaaaattgtgccctatagaattcagaatagaacaaatccccttctccaaaatctccagt |
164 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704378 |
aaatgagtattgtgagatttatta----attcaatcgtagaaaaaattgtgccctatagaattcagaatagaacaaatccccttctccaaaatctccagt |
44704473 |
T |
|
| Q |
165 |
aacgaaaaataaactatgattttagcttcaataatatatgattaccgttgtgttgtagtaggctagtagcatagcaccggtaatagttgacttatgaaca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704474 |
aacgaaaaataaactatgattttagcttgaataatatatgattaccgttgtgttgtagtaggctagtagcatagcaccggtaatagttgacttatgaaca |
44704573 |
T |
|
| Q |
265 |
gttat |
269 |
Q |
| |
|
||||| |
|
|
| T |
44704574 |
gttat |
44704578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 44704307 - 44704350
Alignment:
| Q |
9 |
gcaattcaatggtgtacatataagacaaatgctgtatgatgtat |
52 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44704307 |
gcaattcaatggtgcacatataagacaaatgctgtatgatgtat |
44704350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University