View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2777_low_16 (Length: 213)
Name: NF2777_low_16
Description: NF2777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2777_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 3 - 136
Target Start/End: Original strand, 7416028 - 7416161
Alignment:
| Q |
3 |
ataatgcagattttaatgatcttggttagcagaagatcacaacatttaatttttcatttcctagatgtacattacaagggagaatatacatgatagagaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416028 |
ataatgcagattttaatgatcttggttagcagaagatcacaacatttaatttttcatttcctagatgtacattacaagggagaatatacatgatagagaa |
7416127 |
T |
 |
| Q |
103 |
caaagcaaataactttctgatatattgctcttgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7416128 |
caaagcaaataactttctgatatattgctcttgt |
7416161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University