View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2777_low_4 (Length: 394)
Name: NF2777_low_4
Description: NF2777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2777_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 13 - 377
Target Start/End: Original strand, 33261176 - 33261545
Alignment:
| Q |
13 |
aaaatgcttacagacccgtaatgcctgcagatgttgctgcttctgtgtacgtgctgaattttcatgattaaactagaaatcttacttgcttatatgttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33261176 |
aaaatgcttacagacccgtaatgcctgcagatgttgctgcttctgtgtacgtgctgaattttcatgattaaactagaaatcttacttgcttatatgttag |
33261275 |
T |
|
| Q |
113 |
ttgattatctaactaagttataatttaattttatgggtctagggctgcaatgcgctctagctatgggcaacacccatacttggttggtggagtaggcaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33261276 |
ttgattatctaactaagttataatttaattttatgggtctagggctgcaatgcgctctagctatgggcaacacccatacttggttggtggagtaggcaat |
33261375 |
T |
|
| Q |
213 |
tcagttagctcaggatctcatgcaactttaatgt----atgaatgacttaactccttcaaatttctatttcttga-tttctctcattataagtgtcattt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33261376 |
tcagttagctcaggatctcatgcaactttaatgtatgaatgaatgacttaactccttcaaatttctatttcttgattttctctcattataagtgtcattt |
33261475 |
T |
|
| Q |
308 |
tttatgcattgtgcttaagaggtcctcttgttgcaggtatcactcccaaacatcggtccctattagtgct |
377 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33261476 |
tttatgcattgtgctaaagaggtcctcttgttgcaggtatcactcccaaacatcgttccctattagtgct |
33261545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University