View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2778_high_9 (Length: 235)
Name: NF2778_high_9
Description: NF2778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2778_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 7639335 - 7639223
Alignment:
| Q |
1 |
aagatgacttgttgtacatcatttataaacaaacttgcatatcttttatttgttagtcaataacctataagaatannnnnnngaataaacctataaaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| || |||| |
|
|
| T |
7639335 |
aagatgacttgttgtacatcatttataaacaaacttgcatatcttttatttgttaatcaataacctataagaatatttttttgaataaacccat--aagt |
7639238 |
T |
 |
| Q |
101 |
atacttgttagcatg |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7639237 |
atacttgttagcatg |
7639223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 7639226 - 7639187
Alignment:
| Q |
172 |
catgcacgggcttctgcttcaataacgaggatgagtagag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7639226 |
catgcacgggcttctgcttcaataacgaggatgagtagag |
7639187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University