View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2778_low_10 (Length: 235)

Name: NF2778_low_10
Description: NF2778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2778_low_10
NF2778_low_10
[»] chr6 (2 HSPs)
chr6 (1-115)||(7639223-7639335)
chr6 (172-211)||(7639187-7639226)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 7639335 - 7639223
Alignment:
1 aagatgacttgttgtacatcatttataaacaaacttgcatatcttttatttgttagtcaataacctataagaatannnnnnngaataaacctataaaagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||       ||||||||| ||  ||||    
7639335 aagatgacttgttgtacatcatttataaacaaacttgcatatcttttatttgttaatcaataacctataagaatatttttttgaataaacccat--aagt 7639238  T
101 atacttgttagcatg 115  Q
    |||||||||||||||    
7639237 atacttgttagcatg 7639223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 7639226 - 7639187
Alignment:
172 catgcacgggcttctgcttcaataacgaggatgagtagag 211  Q
    ||||||||||||||||||||||||||||||||||||||||    
7639226 catgcacgggcttctgcttcaataacgaggatgagtagag 7639187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University