View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2778_low_5 (Length: 369)
Name: NF2778_low_5
Description: NF2778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2778_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 2454489 - 2454679
Alignment:
| Q |
14 |
acctttgtcttggaacactaaaccttaatataaccnnnnnnnnccttgttgaatctcaaacactacaattcaatcaaacattgttgtcaagtttgaattt |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2454489 |
acctttgttttggaacactaaaccttaatataaccaaaaaaa-ccttgttgaatctcaaacactacaattcaatcaaacattgttgtcaagtttgaattt |
2454587 |
T |
 |
| Q |
114 |
tgagttcaaagatctgtgctttattattcatggatagttcagaaaaagttgttgctgtgattatggtgggtggacccaccaaaggtaattgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2454588 |
tgagttcaaagatctgtgctttattattcatggatagttcagaaaaagttgttgctgtgattatggtgggtggacccaccaaaggtaattgg |
2454679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 292 - 362
Target Start/End: Original strand, 2454766 - 2454836
Alignment:
| Q |
292 |
caggaactagatttcgaccactttctttcaatactccaaaacccctttttcctttggcaggtcaacctatg |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2454766 |
caggaactagatttcgaccactttctttcaatactccaaaacccctttttcctttggcaggtcaacctatg |
2454836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University