View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2779_high_18 (Length: 249)

Name: NF2779_high_18

Description: NF2779

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF2779_high_18

[»] chr2 (1 HSPs)

[»] chr8 (1 HSPs)

Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)

Name: chr2

Description:

Target: chr2; HSP #1

Raw Score: 136; E-Value: 5e-71

Query Start/End: Original strand, 99 - 234

Target Start/End: Complemental strand, 5898910 - 5898775

Alignment:

Q	99	ttaccatatttccatggatgcttctaaatatagagctttgaacacaaccaagggtttcagtagttaaggagaattgtttgagaccatgaacaagatcatc	198	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5898910	ttaccatatttccatggatgcttctaaatatagagctttgaacacaaccaagggtttcagtagttaaggagaattgtttgagaccatgaacaagatcatc	5898811	T

Q	199	tataatcacaattgttggcttgaaaacaaagaaact	234	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5898810	tataatcacaattgttggcttgaaaacaaagaaact	5898775	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 31; E-Value: 0.00000002

Query Start/End: Original strand, 100 - 150

Target Start/End: Complemental strand, 34042807 - 34042757

Alignment:

Q	100	taccatatttccatggatgcttctaaatatagagctttgaacacaaccaag	150	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|
T	34042807	taccatatttccatggatgctcttaagtattgagctttgtacacaaccaag	34042757	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]