View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_high_18 (Length: 249)
Name: NF2779_high_18
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 99 - 234
Target Start/End: Complemental strand, 5898910 - 5898775
Alignment:
| Q |
99 |
ttaccatatttccatggatgcttctaaatatagagctttgaacacaaccaagggtttcagtagttaaggagaattgtttgagaccatgaacaagatcatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898910 |
ttaccatatttccatggatgcttctaaatatagagctttgaacacaaccaagggtttcagtagttaaggagaattgtttgagaccatgaacaagatcatc |
5898811 |
T |
 |
| Q |
199 |
tataatcacaattgttggcttgaaaacaaagaaact |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898810 |
tataatcacaattgttggcttgaaaacaaagaaact |
5898775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 150
Target Start/End: Complemental strand, 34042807 - 34042757
Alignment:
| Q |
100 |
taccatatttccatggatgcttctaaatatagagctttgaacacaaccaag |
150 |
Q |
| |
|
||||||||||||||||||||| ||| ||| |||||||| ||||||||||| |
|
|
| T |
34042807 |
taccatatttccatggatgctcttaagtattgagctttgtacacaaccaag |
34042757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University