View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_high_21 (Length: 245)
Name: NF2779_high_21
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_high_21 |
 |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 39379008 - 39379228
Alignment:
| Q |
18 |
aatagacattgcaatttacgcctgttttttcttatgattactctaagcatcttgcatggatgtcaaagaattccaattatttaggatttgaaactttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379008 |
aatagacattgcaatttacgcctgttttttcttatgattactctaagcatcttgcatggatgtcaaagaattccaattatttaggatttgaaactttttg |
39379107 |
T |
 |
| Q |
118 |
gtcctataatttggagtagtaacagatattttatcaatgtcatactttcagtctctctttgtaagttgcaactctctagtctctagctaacttaaaagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379108 |
gtcctataatttggagtagtaacagatattttatcaatgtcatactttcagtctctctttgtaagttgcaactctctagtctctagctaacttaaaagta |
39379207 |
T |
 |
| Q |
218 |
aaattatttgtagaaaccaag |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39379208 |
aaattatttgtagaaaccaag |
39379228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 37 - 77
Target Start/End: Original strand, 39396388 - 39396428
Alignment:
| Q |
37 |
gcctgttttttcttatgattactctaagcatcttgcatgga |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39396388 |
gcctgttttttcttatgattactcgaagcatcttgcatgga |
39396428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 37 - 77
Target Start/End: Complemental strand, 38413 - 38373
Alignment:
| Q |
37 |
gcctgttttttcttatgattactctaagcatcttgcatgga |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38413 |
gcctgttttttcttatgattactcgaagcatcttgcatgga |
38373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University