View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_16 (Length: 276)
Name: NF2779_low_16
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 2747930 - 2747704
Alignment:
| Q |
1 |
gatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattatccatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747930 |
gatgaaaaccatgaatcacaacatggtaaacaaatttgatcggttatggtgtaatatcttgatattttctgtcttcattaaactttatattatccata-- |
2747833 |
T |
|
| Q |
101 |
ccggtctaatgcagcacccgaatggaaggatacggtgactcatgttcatcagcatgcttttataaagaatcgttttactggttttggcaaaaattatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747832 |
ccggtctaatgcagcacccgaatggacggatacggtgactcatgttcatcagcattcttttataaagaatcgttttactggttttggcaaaaattatgct |
2747733 |
T |
|
| Q |
201 |
ataatgggatgggtggtaggttgattata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2747732 |
ataatgggatgggtggtaggttgattata |
2747704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 29 - 229
Target Start/End: Complemental strand, 2755945 - 2755748
Alignment:
| Q |
29 |
aacaaatttgatcggttatggtgtaatatcttgatatttt-ctgtcttcattaaactttatattatccatataccggtctaatgcagcacccgaatggaa |
127 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| ||||||| |||| |||||| ||||||||| || |||| | ||||||||||||| |||||| ||| |
|
|
| T |
2755945 |
aacaaatttgatcagttatggtgtaat--cttaatatttttctgttttcattgaactttataacatgcata--ctggtctaatgcagcccccgaacggac |
2755850 |
T |
|
| Q |
128 |
ggatacggtgactcatgttcatcagcatgcttttataaagaatcgttttactggttttggcaaaaattatgctataatgggatgggtggtaggttgatta |
227 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||| ||| ||||||||||||||||||| ||| ||| |||||||| ||| ||||||||| |||| |
|
|
| T |
2755849 |
ggatacggtgactcatgttcatcaacacgcttttatcaaggatcattttactggttttggcaaagattctgccataatggggtggttggtaggttaatta |
2755750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 104 - 229
Target Start/End: Complemental strand, 2373123 - 2372998
Alignment:
| Q |
104 |
gtctaatgcagcacccgaatggaaggatacggtgactcatgttcatcagcatgcttttataaagaatcgttttactggttttggcaaaaattatgctata |
203 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||||||| ||||||||||| ||| ||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
2373123 |
gtctaatgcagcccccgaacggatggatacggtgactcatgttcatcaacatgcttttatcaaggatcattttactggttttggcaatgattctgctata |
2373024 |
T |
|
| Q |
204 |
atgggatgggtggtaggttgattata |
229 |
Q |
| |
|
||||| || ||||||||| |||||| |
|
|
| T |
2373023 |
atggggtgcttggtaggttaattata |
2372998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University