View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_18 (Length: 269)
Name: NF2779_low_18
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 36223428 - 36223185
Alignment:
| Q |
16 |
atttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatttatactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223428 |
atttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatttatactt |
36223329 |
T |
 |
| Q |
116 |
tggttcacttctcatactatgagtaaaccaaactatgatcaataccctattggcaagaaccgtatgcaacctgtggtaaaagcttccttctcttagaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223328 |
tggttcacttctcatactatgagtaaaccaaactatgatcaataccctattggcaagaaccgtatgcaacctgtggtaaaagcttccttctcttagaaca |
36223229 |
T |
 |
| Q |
216 |
cacctaagccaattttcataatattaatttttatgttacttcat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223228 |
cacctaagccaattttcataatattaatttttatgttacttcat |
36223185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University