View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_21 (Length: 250)
Name: NF2779_low_21
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_21 |
 |  |
|
| [»] scaffold1118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0902 (2 HSPs) |
 |  |  |
|
| [»] scaffold0571 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1118 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: scaffold1118
Description:
Target: scaffold1118; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 1280 - 1444
Alignment:
| Q |
1 |
taggtagcttgtagtgcaagtaagctttatgaactaggatttatttgtgttgcttgaggtacattattcttctcttcatgttctaa---taacctgttca |
97 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
1280 |
taggtagcttgcagtgcaagtaagctttatgaactaggatttatttgtgttgattgaggtacattattctactcttcatgctctaatattaacctgttca |
1379 |
T |
 |
| Q |
98 |
actttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
162 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
1380 |
acttttacttctgaagcacaaagcacaacggctcgaggaggctttgtattcgaaccaagcgactc |
1444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 1194 - 1287
Alignment:
| Q |
1 |
taggtagcttgtagtgcaagtaagctttatgaactaggatttatttgtgttgcttgaggtacattattcttctcttcatgttctaataacctgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1194 |
taggtagcttgtagtgcaagtaagctttatgaactaggatttatttgtgttgcttgaggtacattattcttctcttcatgttctaataatctgt |
1287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 163 - 232
Target Start/End: Original strand, 1281 - 1350
Alignment:
| Q |
163 |
aatctgtctttatacaagtagaaggaacaaaactggcagatacggcaattttctcaatctaatttataaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1281 |
aatctgtctttatacaagtagaaggaacaaaactggcagatacgacaattttctcaatctaatttataaa |
1350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0571 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0571
Description:
Target: scaffold0571; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 162
Target Start/End: Original strand, 6529 - 6602
Alignment:
| Q |
89 |
acctgttcaactttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
162 |
Q |
| |
|
|||||||||||| |||| | | |||||||||| |||| |||||| ||| |||||||||||||| ||||| |||| |
|
|
| T |
6529 |
acctgttcaactctctcctctaaagcacaaagaacaacggctcgaggatgctttgaattcgaaccaagcaactc |
6602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 162
Target Start/End: Original strand, 14389951 - 14390024
Alignment:
| Q |
89 |
acctgttcaactttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
162 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||| |||||| ||| ||||||||| ||| ||||| |||| |
|
|
| T |
14389951 |
acctgttcaactttctcctctgaagcacaaagaacaacggctcgaggatactttgaattagaaccaagcaactc |
14390024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University