View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_28 (Length: 238)
Name: NF2779_low_28
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 2289578 - 2289366
Alignment:
| Q |
17 |
aatttcagcaagtgatgaatagcaaacaattcaaggtgatgaacaggtgaagaaaatggttgataatgaaagtgttatttggagctttgctcaatgaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2289578 |
aatttcagcaagtgatgaatagcaaacagttcaaggtgatgaacaggtgaagaaaatggttgataatgaaagtgttatttggagctttgctcaatgaagt |
2289479 |
T |
 |
| Q |
117 |
agcttagtatcactagttaatacttggtgcttc-----nnnnnnnnngcaaagcttggtagttaggttcttatatgcactttatcaatacttagtgccct |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||| || || ||||||||||||||||||||||| ||||||| |
|
|
| T |
2289478 |
agcttagtatcactagttaatacttagtgcttctttttttttttgttgcaaagcttggtagtaagctttttatatgcactttatcaatactttgtgccct |
2289379 |
T |
 |
| Q |
212 |
taacttttctgtg |
224 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
2289378 |
taacttttttgtg |
2289366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University