View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2779_low_30 (Length: 236)

Name: NF2779_low_30
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2779_low_30
NF2779_low_30
[»] chr4 (1 HSPs)
chr4 (1-178)||(36942436-36942613)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 36942613 - 36942436
Alignment:
1 ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36942613 ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat 36942514  T
101 tggcttctcagctgccactggaaatcgcactgctgtacacactatctcttcatgggattttagctcaactttagaagg 178  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
36942513 tggcttctcagctgccactggaaatcgcactgctgtacacagtatctcttcatgggattttagctcaactttagaagg 36942436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University