View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_30 (Length: 236)
Name: NF2779_low_30
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 36942613 - 36942436
Alignment:
| Q |
1 |
ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942613 |
ttttattcactggttttaataacgtaacttctagcattgtgaatcaacatttatcttccatagttgatcttagactttatctgccagaatttgttactat |
36942514 |
T |
 |
| Q |
101 |
tggcttctcagctgccactggaaatcgcactgctgtacacactatctcttcatgggattttagctcaactttagaagg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942513 |
tggcttctcagctgccactggaaatcgcactgctgtacacagtatctcttcatgggattttagctcaactttagaagg |
36942436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University