View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2779_low_31 (Length: 235)
Name: NF2779_low_31
Description: NF2779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2779_low_31 |
 |  |
|
| [»] scaffold0902 (1 HSPs) |
 |  |  |
|
| [»] scaffold1118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0902 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 1099 - 972
Alignment:
| Q |
96 |
aactaataatattcaaccaatttaaattatggatgcaatggttttttactctaatactcgttttatttcgagaccacagcaaatctcgtatctgtggttg |
195 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
1099 |
aactaataatatttaagcaatttaaattatggatgcaatggttttttactctaatactcgttttatttcggcaccacagcaaaactcgtatctgtggttg |
1000 |
T |
 |
| Q |
196 |
cccatccaaacccacctcgatttgatga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
999 |
cccatccaaacccacctcgatttgatga |
972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1118 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1118
Description:
Target: scaffold1118; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 816 - 758
Alignment:
| Q |
104 |
atattcaaccaatttaaattatggatgcaatggttttttactctaatactcgttttatt |
162 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
816 |
atatttaagcaatttaaattatgaatgcaatggttttttactctaatgctcattttatt |
758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University