View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2780R-Insertion-3 (Length: 227)
Name: NF2780R-Insertion-3
Description: NF2780R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2780R-Insertion-3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 227
Target Start/End: Complemental strand, 10760336 - 10760118
Alignment:
| Q |
9 |
gccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagataatggaagataagacaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760336 |
gccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagataatggaagataagacaac |
10760237 |
T |
|
| Q |
109 |
cacaatagtgaaccagaagaatgtgctccatgaaatggctctgctatgttttctatgatctttcatgagagaaacccaaaacgagaagaaaaatgtaata |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760236 |
cacaatagtgaaccaaaagaatgtgctccatgaaatggctctgctatgttttctatgatctttcatgagagaaacccaaaacgagaagaaaaatgtaata |
10760137 |
T |
|
| Q |
209 |
gtaatgttctttgggttgc |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10760136 |
gtaatgttctttgggttgc |
10760118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University