View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2781_low_3 (Length: 214)
Name: NF2781_low_3
Description: NF2781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2781_low_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 23030727 - 23030925
Alignment:
| Q |
16 |
caaaatttgcactacatataaagtgatacgtaataattatggtgattgtgnnnnnnngtttataggttgtgtgcaaatgggagcaggtggtagagcctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23030727 |
caaaatttgcactacatataaagtgatacgtaataattattgtgattgtgtttttttctttataggttgtgtgcaaatgggagcaggtggtagagcctct |
23030826 |
T |
 |
| Q |
116 |
aatcctccatcacaaaggaaaatagagaatgatgaacatttgaagagggttccaactacaaaaccaccattcacccttggtgaagtcaagaaagcaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23030827 |
aatcctccatcacaaaggaaaatagagaatgatgaacatttgaagagggttccaactacaaaaccaccattcactcttggtgaagtcaagaaagcaatt |
23030925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University