View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2782_low_3 (Length: 279)
Name: NF2782_low_3
Description: NF2782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2782_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 33626852 - 33626685
Alignment:
| Q |
17 |
aattatgaaaatgctctctcacaaaatgacacttaagaaatgatgcagtataaagatctaacacaatgacatgaagacataaaacttgccagtcgtaaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33626852 |
aattatgaaaatgctctctcacaaaatgacacttaagaaatgatgcagtataaagatctaacacaatgacatgaagacataaaacttgccagtcgtagac |
33626753 |
T |
|
| Q |
117 |
tcatggtaaaattttagataacctt-gtcaagaatttcgacgtgtaaaatctaagataatccaacgtt |
183 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33626752 |
tcatggtaaaatttgagataaccttagtcaagaatttcgacgtgtaaaatctaagataatccaacgtt |
33626685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 183 - 266
Target Start/End: Complemental strand, 33626526 - 33626443
Alignment:
| Q |
183 |
tttatttttcttgttgtttatcgtcttctcttgaatacacatggatcaagatacgatgacccaataaggatccgattcgatctc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33626526 |
tttatttttcttgttgtttatcgtcttctcctgtatacacatggatcaagatacgatgacccaataaggatctgattcgatctc |
33626443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University