View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2782_low_5 (Length: 239)
Name: NF2782_low_5
Description: NF2782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2782_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40966324 - 40966103
Alignment:
| Q |
1 |
ttgcttgttttggaagatcccttaaatgaaatgacttggtttttgggtttctctatannnnnnnnnnnnnnnnagatcaaggttttggttttcctcctcc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
40966324 |
ttgcttgttttggaagatcccttcaatgaaatgacttggtttttgggtttgtctat--tttttatttttttttagatcaaggttttggttttcctcctcc |
40966227 |
T |
|
| Q |
101 |
ttttgtaatctatatt---gtggttgtgttgtgctcttatggtttcagtttttcaaagatggaactgaatacaatggtagattcttttcaatttttcctc |
197 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40966226 |
ttttgtaatctatattattgtggctgtgttgtgctcttatggtttcagtttttcaaagatggaactgaatacaatggtagattcttttcaatttttcctc |
40966127 |
T |
|
| Q |
198 |
agtctatctacagaaatgttccac |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40966126 |
agtctatctacagaaatgttccac |
40966103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University