View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2783_high_7 (Length: 276)
Name: NF2783_high_7
Description: NF2783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2783_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 2517699 - 2517584
Alignment:
| Q |
1 |
tttttccgttttcttcttttgttcagcctgctttggtttggaaaagaaccaatattgaatgagtcatgtacttattaggaactgaaagttcattgctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517699 |
tttttccgttttcttcttttgttcagcctgctttggtttggaaaagaaccaatattgaatgagtcatgtacttattaggaactgaaagttcattgctttt |
2517600 |
T |
|
| Q |
101 |
atataattttcccatc |
116 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
2517599 |
atataatcttcccatc |
2517584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 2517474 - 2517424
Alignment:
| Q |
226 |
agcacaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517474 |
agcacaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
2517424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 230 - 276
Target Start/End: Complemental strand, 2506497 - 2506451
Alignment:
| Q |
230 |
caggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2506497 |
caggtatgccaggaatgactgcttatgctggtttctttgaagtaggc |
2506451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 1458972 - 1459019
Alignment:
| Q |
229 |
acaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1458972 |
acaggtatgcctggaatgactgcttatgctggtttctttgaagtaggc |
1459019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 2428679 - 2428726
Alignment:
| Q |
229 |
acaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2428679 |
acaggtatgcctggaatgactgcttatgctggtttctttgaagtaggc |
2428726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 276
Target Start/End: Complemental strand, 2513111 - 2513064
Alignment:
| Q |
229 |
acaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
2513111 |
acaggtatgccaggaatgactgcttattctggtttctttgaagtaggc |
2513064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 228 - 276
Target Start/End: Complemental strand, 2497772 - 2497724
Alignment:
| Q |
228 |
cacaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
2497772 |
cacaggtatgccaggaataactgcttatgctggtttctttgaactaggc |
2497724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 2435046 - 2435093
Alignment:
| Q |
229 |
acaggtatgccaggaatgaccgcttatgctggtttctttgaagtaggc |
276 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||| ||||| |
|
|
| T |
2435046 |
acaggtatgccgggaatgactgcatatgctggtttctttgaattaggc |
2435093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University