View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2784-Insertion-15 (Length: 157)
Name: NF2784-Insertion-15
Description: NF2784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2784-Insertion-15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 22927048 - 22926899
Alignment:
| Q |
8 |
gttttagtcttaataattcgtttggttgaaattaagtcattggtatccatgggaaaattattttaagtnnnnnnngtagtgaagaaattgtataaatatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22927048 |
gttttagtcttaataattcgtttggttgaaattaagtcattggtatccatgggaaaattatttttttaaaaaaaagtagtgaagaaattgtataaatatt |
22926949 |
T |
 |
| Q |
108 |
cttcaatttctatttgtgcagtatatgttgttttcttgaagatttcttaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22926948 |
cttcaatttctatttgtgcagtatatgttgttttcttgaagatttcttaa |
22926899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University