View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2784R-Insertion-5 (Length: 427)
Name: NF2784R-Insertion-5
Description: NF2784R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2784R-Insertion-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 3e-58; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 89 - 211
Target Start/End: Original strand, 9811926 - 9812048
Alignment:
| Q |
89 |
agtatgaatcacatttgaaagtaaatatttttctattttgttaaattgaatgtgtgtaagatatttcagttttgagctcagccttatttcgtctctctta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9811926 |
agtatgaatcacatttgaaagtaaatatttttctattttgttaaattgaatgtgtgtaagatatttcagttttgagctcagccttattttatctctctta |
9812025 |
T |
|
| Q |
189 |
aaaatcaaggaacccatattagt |
211 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9812026 |
aaaatcaaggaacccatattagt |
9812048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 9812123 - 9812188
Alignment:
| Q |
210 |
gtaaatcagttttacactgatctagcaaaaatttattatttggtcacatccttccacttttgtaac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9812123 |
gtaaatcagttttacactgatctagcaaaaatttattatttggtcacatccttccactttggtaac |
9812188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 9811108 - 9811151
Alignment:
| Q |
9 |
aataatacgagttaacttggtatgactcaaaaaagaagtgcaat |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9811108 |
aataatacgagttaacttggtatgactcaaaaaagaagtgcaat |
9811151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 53 - 97
Target Start/End: Original strand, 9811288 - 9811332
Alignment:
| Q |
53 |
actagatttttattggcatatatttttctatttgacagtatgaat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9811288 |
actagatttttattggcatatatttttctatttgacggtatgaat |
9811332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University