View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2784R-Insertion-8 (Length: 315)
Name: NF2784R-Insertion-8
Description: NF2784R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2784R-Insertion-8 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 188 - 315
Target Start/End: Complemental strand, 7378101 - 7377974
Alignment:
| Q |
188 |
tactttttatcaatttgtgtaaagaaacttcattttggtgggaaactcggtttccttagtgtgtaagagttaactgctgcaggttccattatatacataa |
287 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7378101 |
tactttttatcaatttgtgtagagaaacttcattttggtgggaaactcagtttccttagtgtgtaagagttaactgctgcaggttccattatatacataa |
7378002 |
T |
|
| Q |
288 |
aggttttaggctttagatttttcttgtt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7378001 |
aggttttaggctttagatttttcttgtt |
7377974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 9 - 148
Target Start/End: Complemental strand, 7378277 - 7378141
Alignment:
| Q |
9 |
tacctgactaaatctaacttcattttttgttgcttttataattggcacgaaattacattttaacaacnnnnnnnnnnnctgctggtgttaaccgtgaggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7378277 |
tacctgactaaatctaacttcattttttgttgcttttataattggcacgaaattacattttaacaa---aaaaaataattgttggtgttaaccgtgaggt |
7378181 |
T |
|
| Q |
109 |
aagtataaccatcaaccatttaattagacattaaacattc |
148 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7378180 |
aagtataactatcaaccatttaattagacattaaacattc |
7378141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 306
Target Start/End: Complemental strand, 7372253 - 7372212
Alignment:
| Q |
265 |
tgcaggttccattatatacataaaggttttaggctttagatt |
306 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
7372253 |
tgcaggttccatgatagacataaaggtcttaggctttagatt |
7372212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University