View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2785_low_10 (Length: 323)
Name: NF2785_low_10
Description: NF2785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2785_low_10 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 323
Target Start/End: Original strand, 32142449 - 32142749
Alignment:
| Q |
18 |
ggaggaacgtcgaacgaaaccatttaagtatattataggaggccgttaaggacaagcaagagaatgatatgctaccttatgtaggagatgaataaccttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142449 |
ggaggaacgtcgaacgaaaccatttaagtatattctaggaggccgttaaggacaagcaagagaatgatatgctaccttatgtaggagatgaataaccttc |
32142548 |
T |
 |
| Q |
118 |
ctatttatttatttgatttcatnnnnnnnnnnnnnnnnnnnntttaggagtatttcataaattcttgatcttatatccttatgtcatacatacatatgag |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32142549 |
ctatttatttatttgatttcataaaaaaaaaaaatct-----tttaggagtatttcataaattcttgatcttatgtccttatgtcatacatacatatgag |
32142643 |
T |
 |
| Q |
218 |
catgctcaaatttaatgtgcaattgcagtcgtgaggatgcttcatcatttatatataaaaacaataaaataaaactttcgaaggggaagtgatttggctc |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
32142644 |
catgctcaaatttaatgcgcaattgcagtcgtgaggatgcttcatcatttatatataaaaacaataaattacaactttcaaaggggaagtgatttggctc |
32142743 |
T |
 |
| Q |
318 |
aacctc |
323 |
Q |
| |
|
|||||| |
|
|
| T |
32142744 |
aacctc |
32142749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 265 - 323
Target Start/End: Original strand, 32150767 - 32150825
Alignment:
| Q |
265 |
tttatatataaaaacaataaaataaaactttcgaaggggaagtgatttggctcaacctc |
323 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
32150767 |
tttatatataaaaacaataaaatacaactttcgaaggggaagcgatttggctcaacctc |
32150825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University