View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2785_low_11 (Length: 310)
Name: NF2785_low_11
Description: NF2785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2785_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 180 - 294
Target Start/End: Complemental strand, 27244046 - 27243932
Alignment:
| Q |
180 |
tcataaacactaagcagatgaattaaccaatgattcaaatcagtggaagtctttagattgatttttcaaccatcatcaagaaaacaatttgatgggatcg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244046 |
tcataaacactaagcagatgaattaaccaatgattcaaatcagtggaagtccttagactgatttttcaaccatcatcaagaaaacaatttgatgggatcg |
27243947 |
T |
 |
| Q |
280 |
attgatcgatcaaat |
294 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27243946 |
attgatcgatcaaat |
27243932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 27244209 - 27244144
Alignment:
| Q |
19 |
ctatagtaacaatacatttgtttgctatctttcacgaaattattttcgttaaatacaacattttcg |
84 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27244209 |
ctatagtaacaatacatttgttcgctatctttcacgaaattattttcgttatatacaacattttcg |
27244144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University